Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4914868
End position: 4914892
Length: 25

DNA sequence
>NC_016906, from 4914868 to 4914892 (25 bp); Gordonia polyisoprenivorans VH2 AGCCGCGCCGCGCCGAGGCGGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4914805-4915725	Sequence	GPOL_c43270 panC pantothenate synthetase PanC (Protein is coded in complementary strand; from 4915725 to 4914805)