Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3954576
End position: 3954600
Length: 25

DNA sequence
>NC_016906, from 3954576 to 3954600 (25 bp); Gordonia polyisoprenivorans VH2 CGCGCCGCGGCGAGCTGCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3953046-3955016	Sequence	GPOL_c35160 - putative 4-hydroxyphenylpyruvate dioxygenase (Protein is coded in complementary strand; from 3955016 to 3953046)