Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1811174
End position: 1811198
Length: 25

DNA sequence
>NC_016906, from 1811174 to 1811198 (25 bp); Gordonia polyisoprenivorans VH2 CGGCCCGGACCGGCTCGGCGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1810078-1811514	Sequence	GPOL_c15890 - putative carbohydrate kinase, YjeF family protein