Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 746887
End position: 746910
Length: 24

DNA sequence
>NC_016906, from 746887 to 746910 (24 bp); Gordonia polyisoprenivorans VH2 GAAGTCGACGTCGGAGTCGAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 746753-758182	Sequence	GPOL_c06250 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 758182 to 746753)