Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 737573
End position: 737596
Length: 24

DNA sequence
>NC_016906, from 737573 to 737596 (24 bp); Gordonia polyisoprenivorans VH2 GTCGTCGGCGTCATCGTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 735207-739100	Sequence	GPOL_c06170 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 739100 to 735207)