Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 687449
End position: 687472
Length: 24

DNA sequence
>NC_016906, from 687449 to 687472 (24 bp); Gordonia polyisoprenivorans VH2 CCACGGCCGCGGCCACCGCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 686020-687792	Sequence	GPOL_c05780 - putative transmembrane protein (Protein is coded in complementary strand; from 687792 to 686020)