Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5600780
End position: 5600803
Length: 24

DNA sequence
>NC_016906, from 5600780 to 5600803 (24 bp); Gordonia polyisoprenivorans VH2 GTCGGAGTCCGAGTCGTAGTCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5600748-5602103	Sequence	GPOL_c49690 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 5602103 to 5600748)