Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5350890
End position: 5350913
Length: 24

DNA sequence
>NC_016906, from 5350890 to 5350913 (24 bp); Gordonia polyisoprenivorans VH2 CGCCAGCGTCAGCGGCAGCCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5350012-5351331	Sequence	GPOL_c47340 murF2 UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase MurF (Protein is coded in complementary strand; from 5351331 to 5350012)