Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5242057
End position: 5242080
Length: 24

DNA sequence
>NC_016906, from 5242057 to 5242080 (24 bp); Gordonia polyisoprenivorans VH2 CGGCGGCGGAGGCGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5241947-5243236	Sequence	GPOL_c46350 - hypothetical protein (Protein is coded in complementary strand; from 5243236 to 5241947)