Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5158132
End position: 5158155
Length: 24

DNA sequence
>NC_016906, from 5158132 to 5158155 (24 bp); Gordonia polyisoprenivorans VH2 GCCGTCGCTGTCGCCGTTGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5158039-5159211	Sequence	GPOL_c45550 - hypothetical protein (Protein is coded in complementary strand; from 5159211 to 5158039)