Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4616193
End position: 4616216
Length: 24

DNA sequence
>NC_016906, from 4616193 to 4616216 (24 bp); Gordonia polyisoprenivorans VH2 CGATGACGAAGACGGTGAAGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4615727-4616656	Sequence	GPOL_c40500 pstA phosphate ABC transporter permease PstA (Protein is coded in complementary strand; from 4616656 to 4615727)