Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 457259
End position: 457282
Length: 24

DNA sequence
>NC_016906, from 457259 to 457282 (24 bp); Gordonia polyisoprenivorans VH2 CGACGAAGACGACGATGAAGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 456400-457800	Sequence	GPOL_c03950 - putative amino acid permease (Protein is coded in complementary strand; from 457800 to 456400)