Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4558855
End position: 4558878
Length: 24

DNA sequence
>NC_016906, from 4558855 to 4558878 (24 bp); Gordonia polyisoprenivorans VH2 ACGTCGACGTGGGCGTCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4558066-4559706	Sequence	GPOL_c39990 - putative adenylate/guanylate cyclase (Protein is coded in complementary strand; from 4559706 to 4558066)