Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4536353
End position: 4536376
Length: 24

DNA sequence
>NC_016906, from 4536353 to 4536376 (24 bp); Gordonia polyisoprenivorans VH2 ACGGCGACGACGAAGGCGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4536224-4536655	Sequence	GPOL_c39800 moaE molybdenum cofactor biosynthesis protein E (Protein is coded in complementary strand; from 4536655 to 4536224)