Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4481378
End position: 4481401
Length: 24

DNA sequence
>NC_016906, from 4481378 to 4481401 (24 bp); Gordonia polyisoprenivorans VH2 GCTGTCGCTGTCGCTGTCGCTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4480230-4481825	Sequence	GPOL_c39290 - hypothetical protein (Protein is coded in complementary strand; from 4481825 to 4480230)