Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4419258
End position: 4419281
Length: 24

DNA sequence
>NC_016906, from 4419258 to 4419281 (24 bp); Gordonia polyisoprenivorans VH2 TGTCGGTCTCGGTGTCGGTGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4418054-4419685	Sequence	GPOL_c38740 - hypothetical protein (Protein is coded in complementary strand; from 4419685 to 4418054)