Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4369249
End position: 4369272
Length: 24

DNA sequence
>NC_016906, from 4369249 to 4369272 (24 bp); Gordonia polyisoprenivorans VH2 CGGCGGCGTCGGCCGCGGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4368408-4369337	Sequence	GPOL_c38320 - hypothetical protein (Protein is coded in complementary strand; from 4369337 to 4368408)