Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4320603
End position: 4320626
Length: 24

DNA sequence
>NC_016906, from 4320603 to 4320626 (24 bp); Gordonia polyisoprenivorans VH2 GTCGCCTCGTCGCGTCGTTGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4320432-4321400	Sequence	GPOL_c37910 cfa2 cyclopropane-fatty-acyl-phospholipid synthase (Protein is coded in complementary strand; from 4321400 to 4320432)