Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4199791
End position: 4199814
Length: 24

DNA sequence
>NC_016906, from 4199791 to 4199814 (24 bp); Gordonia polyisoprenivorans VH2 CCGAGGCCGCGGGCGAGGTCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4199695-4200318	Sequence	GPOL_c36870 - putative TetR family transcriptional regulator (Protein is coded in complementary strand; from 4200318 to 4199695)