Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4096499
End position: 4096522
Length: 24

DNA sequence
>NC_016906, from 4096499 to 4096522 (24 bp); Gordonia polyisoprenivorans VH2 GGCGATGGCGGTGCCGATGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4092360-4100639	Sequence	GPOL_c35920 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 4100639 to 4092360)