Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3515527
End position: 3515550
Length: 24

DNA sequence
>NC_016906, from 3515527 to 3515550 (24 bp); Gordonia polyisoprenivorans VH2 ACCGTGACGGTGACCGCGACGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3515473-3516213	Sequence	GPOL_c31030 myrA mycinamicin-resistance protein MyrA (Protein is coded in complementary strand; from 3516213 to 3515473)