Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3232752
End position: 3232775
Length: 24

DNA sequence
>NC_016906, from 3232752 to 3232775 (24 bp); Gordonia polyisoprenivorans VH2 TCGGCGACGGCGTCGACGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3230142-3233099	Sequence	GPOL_c28470 glnE glutamate-ammonia-ligase adenylyltransferase GlnE (Protein is coded in complementary strand; from 3233099 to 3230142)