Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2939657
End position: 2939680
Length: 24

DNA sequence
>NC_016906, from 2939657 to 2939680 (24 bp); Gordonia polyisoprenivorans VH2 CGGCGTCGACGTCGGAGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2939008-2939949	Sequence	GPOL_c25910 - hypothetical protein (Protein is coded in complementary strand; from 2939949 to 2939008)