Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 275489
End position: 275512
Length: 24

DNA sequence
>NC_016906, from 275489 to 275512 (24 bp); Gordonia polyisoprenivorans VH2 CGACCCCGACCACGACACCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 274308-275708	Sequence	GPOL_c02300 - cytochrome P450 (Protein is coded in complementary strand; from 275708 to 274308)