Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2675405
End position: 2675428
Length: 24

DNA sequence
>NC_016906, from 2675405 to 2675428 (24 bp); Gordonia polyisoprenivorans VH2 CGGTGTCGGCGTCGGTGTCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2670997-2684454	Sequence	GPOL_c23590 - putative non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 2684454 to 2670997)