Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2662268
End position: 2662291
Length: 24

DNA sequence
>NC_016906, from 2662268 to 2662291 (24 bp); Gordonia polyisoprenivorans VH2 CGACGTCGACCTCGCCGTCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2662228-2664492	Sequence	GPOL_c23520 mutB methylmalonyl-CoA mutase large subunit MutB