Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2624306
End position: 2624329
Length: 24

DNA sequence
>NC_016906, from 2624306 to 2624329 (24 bp); Gordonia polyisoprenivorans VH2 CAGCGCCAGTGCCACCGCCAGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2622582-2624810	Sequence	GPOL_c23220 - hypothetical protein (Protein is coded in complementary strand; from 2624810 to 2622582)