Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1200860
End position: 1200883
Length: 24

DNA sequence
>NC_016906, from 1200860 to 1200883 (24 bp); Gordonia polyisoprenivorans VH2 TCGTCGTCGGCGTCGTGGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1199921-1201072	Sequence	GPOL_c10440 - HAD-superfamily hydrolase (Protein is coded in complementary strand; from 1201072 to 1199921)