Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1172267
End position: 1172290
Length: 24

DNA sequence
>NC_016906, from 1172267 to 1172290 (24 bp); Gordonia polyisoprenivorans VH2 GGCGATGGTGATCGCGATGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1171869-1172756	Sequence	GPOL_c10160 - putative ABC metal ion transporter, permease component (Protein is coded in complementary strand; from 1172756 to 1171869)