Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 761002
End position: 761034
Length: 33

DNA sequence
>NC_016894, from 761002 to 761034 (33 bp); Acetobacterium woodii DSM 1030 GAGGAAAAAAAGACGGAAAAAACAGAAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 760557-761180	Sequence	Awo_c06620 - hypothetical protein (Protein is coded in complementary strand; from 761180 to 760557)