Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 4001741
End position: 4001776
Length: 36

DNA sequence
>NC_016894, from 4001741 to 4001776 (36 bp); Acetobacterium woodii DSM 1030 TCTATCTGTGTTTACATCTGTGTTTATATCTGTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4001340-4002158	Sequence	Awo_c35220 - bacteriophage-like protein (Protein is coded in complementary strand; from 4002158 to 4001340)