Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 3740504
End position: 3740527
Length: 24

DNA sequence
>NC_016894, from 3740504 to 3740527 (24 bp); Acetobacterium woodii DSM 1030 ATAATCATAATTAAAATCATAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3739862-3741214	Sequence	Awo_c32660 mef macrolide-efflux protein, major facilitator superfamily MFS-1 (Protein is coded in complementary strand; from 3741214 to 3739862)