Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 3594773
End position: 3594817
Length: 45

DNA sequence
>NC_016894, from 3594773 to 3594817 (45 bp); Acetobacterium woodii DSM 1030 TATCTATACTAACCTCACCTATACTACCCTTACCTAACCTAACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3594409-3595278	Sequence	Awo_c31180 - putative phage replication initiation protein (Protein is coded in complementary strand; from 3595278 to 3594409)