Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 3389916
End position: 3389942
Length: 27

DNA sequence
>NC_016894, from 3389916 to 3389942 (27 bp); Acetobacterium woodii DSM 1030 TTCGTGTTATTCGTGTTATTCGTGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3389463-3390554	Sequence	Awo_c29360 - hypothetical protein (Protein is coded in complementary strand; from 3390554 to 3389463)