Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 3257631
End position: 3257654
Length: 24

DNA sequence
>NC_016894, from 3257631 to 3257654 (24 bp); Acetobacterium woodii DSM 1030 AAAAGTGAAAGTAAAAGAAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3257636-3259090	Sequence	Awo_c27950 rocR arginine utilization regulatory protein RocR