Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2938303
End position: 2938347
Length: 45

DNA sequence
>NC_016894, from 2938303 to 2938347 (45 bp); Acetobacterium woodii DSM 1030 TGAACTGGTGCTTGTTGAACTGGTGCTTGCTGAACTGGAGCTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2937868-2939001	Sequence	Awo_c25130 fliN flagellar motor switch protein FliN (Protein is coded in complementary strand; from 2939001 to 2937868)