Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2881801
End position: 2881836
Length: 36

DNA sequence
>NC_016894, from 2881801 to 2881836 (36 bp); Acetobacterium woodii DSM 1030 TTCCATTTCTTTTTCGGTTTCTTTTAGCATTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2881760-2882209	Sequence	Awo_c24570 fliJ flagellar export protein FliJ (Protein is coded in complementary strand; from 2882209 to 2881760)