Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2642511
End position: 2642540
Length: 30

DNA sequence
>NC_016894, from 2642511 to 2642540 (30 bp); Acetobacterium woodii DSM 1030 ATTTTTGTTCATTTTGTTTCATTTCTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2642504-2643355	Sequence	Awo_c22510 - hypothetical protein (Protein is coded in complementary strand; from 2643355 to 2642504)