Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 260208
End position: 260252
Length: 45

DNA sequence
>NC_016894, from 260208 to 260252 (45 bp); Acetobacterium woodii DSM 1030 CTTGATGAATCAGAACTTGATGAATCAGAACTTGATGAATCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 260100-261656	Sequence	Awo_c02280 - hypothetical protein (Protein is coded in complementary strand; from 261656 to 260100)