Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2559240
End position: 2559263
Length: 24

DNA sequence
>NC_016894, from 2559240 to 2559263 (24 bp); Acetobacterium woodii DSM 1030 CTTCGATACTTTGATACTTCGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2558681-2559328	Sequence	Awo_c21710 - hypothetical protein (Protein is coded in complementary strand; from 2559328 to 2558681)