Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2498474
End position: 2498497
Length: 24

DNA sequence
>NC_016894, from 2498474 to 2498497 (24 bp); Acetobacterium woodii DSM 1030 ATAATCATCATCATAATAATACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2498220-2498576	Sequence	Awo_c21190 - putative DNA-binding protein (Protein is coded in complementary strand; from 2498576 to 2498220)