Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2490508
End position: 2490543
Length: 36

DNA sequence
>NC_016894, from 2490508 to 2490543 (36 bp); Acetobacterium woodii DSM 1030 TGTTACTGGTTGTGTTACTGGTTGTGTTACTGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2489321-2490688	Sequence	Awo_c21070 - hypothetical protein (Protein is coded in complementary strand; from 2490688 to 2489321)