Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 2366373
End position: 2366402
Length: 30

DNA sequence
>NC_016894, from 2366373 to 2366402 (30 bp); Acetobacterium woodii DSM 1030 TCAATTTCTTTCCATTTTTTTTCATTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2365406-2366398	Sequence	Awo_c19930 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 2366398 to 2365406)