Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 1969563
End position: 1969586
Length: 24

DNA sequence
>NC_016894, from 1969563 to 1969586 (24 bp); Acetobacterium woodii DSM 1030 CGCCTCCGCCCCCGCCCCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1969550-1971466	Sequence	Awo_c16720 - hypothetical protein (Protein is coded in complementary strand; from 1971466 to 1969550)