Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 1435170
End position: 1435223
Length: 54

DNA sequence
>NC_016894, from 1435170 to 1435223 (54 bp); Acetobacterium woodii DSM 1030 CGGTATCGGGAGCAATATCGGTATCGGGAGCAATATCGGTATCGGGAGCAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1434746-1435270	Sequence	Awo_c12300 - hypothetical protein (Protein is coded in complementary strand; from 1435270 to 1434746)