Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 1313493
End position: 1313522
Length: 30

DNA sequence
>NC_016894, from 1313493 to 1313522 (30 bp); Acetobacterium woodii DSM 1030 ATGAATAGAAAGGACTAGAAATGATTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1312734-1313501	Sequence	Awo_c11430 - hypothetical protein
ORF... 1313514-1313810	Sequence	Awo_c11440 - hypothetical protein