Sequence retrieval

Genome: Acetobacterium woodii DSM 1030
Start position: 1198425
End position: 1198469
Length: 45

DNA sequence
>NC_016894, from 1198425 to 1198469 (45 bp); Acetobacterium woodii DSM 1030 AAGAAGAACAAGAAGAACAAGAAGAACAAGAAGAACAAGAAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1197537-1199495	Sequence	Awo_c10330 chlI1 magnesium chelatase 67 kDa subunit ChlI