Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 663924
End position: 663947
Length: 24

DNA sequence
>NC_016856, from 663924 to 663947 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S TGGTGGTGGTCGTGGTGCTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 661968-664073	Sequence	STM14_0699 cstA carbon starvation protein