Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 4352969
End position: 4352998
Length: 30

DNA sequence
>NC_016856, from 4352969 to 4352998 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S CGCGGTAAATCTCGATAAATGGCGGTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4351858-4353009	Sequence	STM14_4955 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4353009 to 4351858)