Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 4104577
End position: 4104600
Length: 24

DNA sequence
>NC_016856, from 4104577 to 4104600 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S TGATCATGTTCACGATCATGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4103287-4105155	Sequence	STM14_4677 trkD potassium transport protein Kup